Arbeitsblatt: Der genetische Fingerabdruck

Material-Details

AB zur Erstellung eines Bandenmusters
Biologie
Genetik
12. Schuljahr
10 Seiten

Statistik

175105
916
9
04.10.2017

Autor/in

Marlies de Vries
Land: Deutschland
Registriert vor 2006

Downloads Arbeitsblätter / Lösungen / Zusatzmaterial

Die Download-Funktion steht nur registrierten, eingeloggten Benutzern/Benutzerinnen zur Verfügung.

Textauszüge aus dem Inhalt:

Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 1 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorts vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: 3 GGTCCGGGAGATAGATAGATCCTGCCTAATGAGTT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATAGATAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 1 Bandenmuster Gelelektrophorese – Genort 1 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 2 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorts vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATAGATAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: 3 GGTCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCAATGAGTT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 2 Bandenmuster Gelelektrophorese – Genort 2 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 3 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorts vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: 3 GGTCCGGGAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCAATGAGTT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 3 Bandenmuster Gelelektrophorese – Genort 3 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 4 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorte vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATAGATAGATAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: a) 3 GGTCCGGGAGATAGATAGATAGATAGATAGATAGATCCTGCCAATGAGTT 5 b) 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCAAT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 4 Bandenmuster Gelelektrophorese – Genort 4 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 5 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorts vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: a) 3 GGTCCGGGAGATAGATAGATAGATCCTGCCAATGAGTT 5 b) 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCAAT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 5 Bandenmuster Gelelektrophorese – Genort 5 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 6 Vergleich der Spuren mithilfe des genetischen Fingerabdrucks Aus DNA-Spuren von einem Tatort wurden mittels PCR die STRs eines bestimmten Genorts vervielfältigt und anschließend gelelektrophoretisch aufgetrennt. Das Beweismaterial gibt das Ergebnis der Untersuchung wieder. Von zwei Tatverdächtigen sowie dem Opfer wurde anschließend eine STR-Analyse des gleichen Genorts durchgeführt. (verändert nach: Walory, M.; Westendorf-Bröring, E. (2012): Biologie Heute SII. Lehrermaterialien Teil 1. Schroedel Verlag, Braunschweig) Aufgabenstellung: 1. Ermittelt mithilfe der untenstehenden DNA-Sequenzen die Anzahl der repeats des untersuchten Genorts für die zwei Tatverdächtigen sowie das Opfer und markiert diese farbig. Tragt die Anzahl anschließend in die Tabelle ein. 2. Die Primer begrenzen den STR- Bereich auf beiden Seiten und bestehen im vorliegenden Fall aus sechs Nucleotiden. Markiert die Primer in einer anderen Farbe. 3. Primer und repeats zusammen ergeben die Länge des DNA-Abschnitts in Basenpaaren (bp). Tragt die Länge in bp in die Tabelle ein und zeichnet die entsprechenden Banden in das Elektrophoresegel ein. Orientiert euch dabei an den Fragmentlängen des Markers. 4. Übertragt euer Bandenmuster auf das im Klassenraum aushängende Plakat. DNA-Sequenzen: Opfer: 3 ATATCCGGGAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCCAATG 5 Tatverdächtiger 1: 3 GGTCCGGGAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTGCCAATGAGTT 5 Tatverdächtiger 2: 3 GGCATCCGGGAGATAGATCCTGCCGAATCCAATACGGA 5 Analyse der STRs sowie der Längen der DNA-Abschnitte Opfer (Hans S.) Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Anzahl der Wiederholungen der STR Länge des DNAAbschnitts in bp inklusive der Primer 1 Kurs: BIG – Dem Täter auf der Spur Datum: Wer ist der Mörder von Hans S.? Genort 6 Bandenmuster Gelelektrophorese – Genort 6 Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Beweismaterial Tatverdächtiger 1 (Martin B.) Tatverdächtiger 2 (Hanno S.) Bandenmuster Gelelektrophorese – alle Genorte Marker 70 bp 65 bp 60 bp 55 bp 50 bp 45 bp 40 bp 35 bp 30 bp 25 bp 20 bp Opfer (Hans S.) Material verändert nach: • Schulportal (o.J.): Unterrichtsentwurf zum vierten Unterrichtsbesuch. STR-Analyse als eine Möglichkeit zur Erstellung eines genetischen Fingerabdrucks für die Identifizierung eines Täters. Online verfügbar unter: 139454-115495/Nordrhein-Westfalen/Gymnasium_FOS/Biologie-Klasse_12-Unterrichtsentwurf_LehrprobeGentechnik.html [Letzter Zugriff: 26.08.2017] • Bohlen, S. et al. (2015): Abibox Biologie. Biologie der Zelle. Energiegewinnung. Lehrermappe. Brinkmann, Meyerhöfer, Hannover 2